component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] type III secretion system residing in the forespore membrane, required for [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activation
function
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], forespore encasement by the spore coat
product
part of the transmembrane channel linking the mother cell and the forespore
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion][category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]Gene
Coordinates
2,532,353 2,533,009
Phenotypes of a mutant
reduced sporulation efficiency (1 to 10% compared to wild type) [Pubmed|26735940]the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe sporulation defect (0.001%) [Pubmed|26735940]block of sporulation after engulfmentThe protein
Catalyzed reaction/ biological activity
required for forespore encasement by the spore coat [Pubmed|22171814]Structure
[PDB|3UZO]; [PDB|3TUF] (the [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]-[protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] pore forming complex) [Pubmed|22431604,22431613][SW|Localization]
membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]) [Pubmed|22431604,22431613,22171814,18485064]proper recruitment to the sporulation septum on the mother cell side requires [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|23834622]Expression and Regulation
Operons
genes
[gene|70408C17CF8681998F7FD933D4BFF71D052626D9|yqhV]-[gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
description
[Pubmed|1766372]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]regulation
both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]view in new tabgenes
[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
description
[Pubmed|17693505]
regulation
both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]view in new tabgenes
[gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
description
[Pubmed|18485064]
regulation
both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]view in new tabBiological materials
Mutant
BKE24360 ([gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGCBKK24360 ([gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGClabs
[SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]References
Reviews
23944268,25105965,31350897 Original publications
15752199,18485064,15574594,18812514,1766372,17693505,19609349,17121846,21097616,22431613,22171814,23834622,22431604,23859254,25356555,26735940,27381174,27681621